Transgenic and in vitro studies indicate that loss of K14 cannot be completely compensated for by the ectopic expression of other keratins (Hutton et al., 1998; Paladini and Coulombe, 1998). Keratins (also described as cytokeratins) are polymers of type I and type II intermediate filaments that have been found only in chordates (vertebrates, amphioxus, urochordates). To create the GFP-tagged K14 construct, K14 (a kind gift from Kozo Yoneda, Departments of Dermatology and Physiology, Akita University School of Medicine, Akita, Japan) was subcloned in pEGFP-N3 (Clontech, Mountain View, CA) and digested with XbaI and BamHI.

It is reduced, but not absent, in the ichthyoses.18 However, the process of desquamation (dyshesion) is more complex than simple desmosomal degeneration.19 It is known that cholesterol esters are important components of cell adhesion.

4, Journal of Pharmacological and Toxicological Methods, Vol. Keratinization varies based on degree of differentiation; poorly differentiated tumors only focally exhibit keratinization.129 In nonkeratinizing squamous cell carcinoma, epithelial nests typically lack maturation.

It has been proposed that keratins can be divided into 'hard' and 'soft' forms, or 'cytokeratins' and 'other keratins'. [16] This model has been confirmed by the determination of the crystal structure of a helical domain of keratins. (A and B) Cell proliferation curves of K14 knockdown and vector control cells using MTT assay. Robert M. Kliegman MD, in Nelson Textbook of Pediatrics, 2020. Enter your email address below and we will send you your username, If the address matches an existing account you will receive an email with instructions to retrieve your username. 5, 23 October 2014 | Scientific Reports, Vol. 30, No. The biologically and commercially useful properties of silk fibers depend on the organization of multiple adjacent protein chains into hard, crystalline regions of varying size, alternating with flexible, amorphous regions where the chains are randomly coiled. 7, No. Copyright 2022 Elsevier B.V. or its licensors or contributors. It is thought that cholesterol sulfate inhibits proteases that are involved in desquamation.20 Lipids also play a role in the permeability barrier of the skin, a function which resides in the region of the granular layer.21,22 Lipids secreted by the Odland bodies (see above) are an important component of the permeability barrier. Tumors that express keratin include carcinomas, thymomas, sarcomas and trophoblastic neoplasms. In particular, more peptides over 2000Da were matched than by other methods. Elevated nuclear levels of Notch1 correlated with increased NICD levels. 34, 25 May 2018 | Cell Stress and Chaperones, Vol. 5.16). Since cell differentiation and Notch 1 activation have been shown to be associated with cell adhesion (Watt et al., 2008), we analyzed cellextracellular matrix (ECM) and cellcell adhesion in K14 knockdown and vector control cells (methods described in Supplemental Material). FIGURE 4: Alterations in cell differentiationassociated molecules. Recently K8 has also been shown to interact with Akt1, and regulate its phosphorylation in a glycosylation-dependent manner in simple epithelial cells (Ku et al., 2011). (Thunb.) (A and B) Western blot analysis of stable K14 knockdown and the respective vector control clones with antibodies to NICD. Krt14 9, No. This model will also provide a better system for studying the role of K5 and K14 in a differentiation program and lead to new information regarding stratification of these epithelia. One of these is profilaggrin. These clones demonstrated significant reduction in protein level (Figure 1A) and 60% decrease in filament formation of K14's normal partner K5 (Figure 1C). (B and C) Western blot analysis of stable K14 knockdown clones (shRK14-D1 and shRK14-D2) and vector controls (pTU6-HaC) with antibodies to cyclin-D1, PCNA, phosphorylated histone-H3, p21, and p27. (A) Representative images of nude mice bearing tumor of indicated clones 8 wk after the injection. A new keratin, designated K6irs, has been localized to the inner root sheath of the hair follicle.7. 9, No. K14 knockdown cells did not show significant increase in cell adhesion to ECM substrates such as matrigel, collagen, and fibronectin in comparison with vector control cells (Figure S4C). Aisling Murphy, Brian Koos, in Encyclopedia of Reproduction (Second Edition), 2018. [15][16] These sequences revealed that there are two distinct but homologous keratin families, which were named type I and type II keratins. 24, No. The keratohyaline granules which give the identifying features to the granular layer result from the accumulation of newly synthesized proteins. This suggests that they originated from a series of gene duplications on these chromosomes. 2, 14 November 2014 | International Forum of Allergy & Rhinology, Vol. They are obligatory heteropolymers and are assembled in 1:1 molar ratio, consisting of one type I and one type II keratin (Moll et al., 1982; Coulombe and Omary, 2002; Herrmann and Aebi, 2004). 142, 3 August 2019 | Oral Cancer, Vol. [27], One of a family of fibrous structural proteins, Learn how and when to remove this template message, Large cell lung carcinoma with rhabdoid phenotype, List of cutaneous conditions caused by mutations in keratins, List of keratins expressed in the human integumentary system, "Keratin: Structure, mechanical properties, occurrence in biological organisms, and efforts at bioinspiration", "Formation, structure, and function of extra-skeletal bones in mammals", "New Aspects of the -Helix to -Sheet Transition in Stretched Hard -Keratin Fibers", "The human keratins: biology and pathology", "New consensus nomenclature for mammalian keratins", "The cDNA sequence of a human epidermal keratin: Divergence of sequence but conservation of structure among intermediate filament proteins", "The cDNA sequence of a type II cytoskeletal keratin reveals constant and variable structural domains among keratins", "Structural basis for heteromeric assembly and perinuclear organization of keratin filaments", "Structure and functions of keratin proteins in simple, stratified, keratinized and cornified epithelia", "Mutation Analysis of Human Cytokeratin 8 Gene in Malignant Rhabdoid Tumor: A Possible Association with Intracytoplasmic Inclusion Body Formation", "Subcellular Distribution of Cytokeratin and Vimentin in Malignant Rhabdoid Tumor: Three-Dimensional Imaging with Confocal Laser Scanning Microscopy and Double Immunofluorescence", "Toward unraveling the complexity of simple epithelial keratins in human disease", Composition and -sheet structure of silk, Hair-Science.com's entry on the microscopic elements of hair, https://en.wikipedia.org/w/index.php?title=Keratin&oldid=1089181642, Short description is different from Wikidata, Wikipedia articles needing clarification from May 2010, Articles needing additional references from January 2022, All articles needing additional references, Creative Commons Attribution-ShareAlike License 3.0, production of small proline-rich (SPRR) proteins and transglutaminase which eventually form a, loss of nuclei and organelles, in the final stages of cornification, This page was last edited on 22 May 2022, at 10:21. To generate efficient shRNA constructs for knockdown of K14, four different sequences were used to generate pTU6 PURO-based short hairpin RNA (shRNA) constructs. However, the percentage of cells in S-phase at 18 h for K14 knockdown clones was significantly reduced compared with vector control (Figure 3A).

67, No. Amino acids levels drop across gestation and are lower than serum levels, with the exception of taurine (Reid etal., 1971; Kerr and Kennan, 1969; Cockburn etal., 1970). 13, 13 June 2020 | International Journal of Molecular Sciences, Vol.

K14 knockdown also led to reduction in tumorigenic potential in AW13516 cells. FIGURE 5: Activation of Notch1 signaling upon K14 knockdown. H.A., S.T.K., and L.S. 197, No. Thus our results suggest that K14 modulates cell proliferation in stratified epithelia, possibly through the PI3K/Akt pathway. FIGURE 6: Tumorigenicity assays for K14 knockdown clones. 70, 1 January 2016 | RSC Advances, Vol. 2011 Alam et al. 1, 20 July 2018 | Genome Medicine, Vol. 94, No. 14, No. 6, Journal of Applied Oral Science, Vol. 3, 8 April 2021 | Aging Cell, Vol.

The ellipsoid volume formula l w h was used to calculate the tumor volume (Tomayko and Reynolds, 1989). 2018- Strikers FC Academy . The differentiation of primary lung squamous cell carcinoma from metastases from head and neck, esophagus, cervix, or cutaneous sites can be challenging and may require molecular correlation with mutation profiles, loss of heterozygosity analysis,138140 or HPV genotyping.141143 Well-differentiated endobronchial squamous carcinoma with papillary configuration can be distinguished from squamous papilloma based on the presence of invasion.144 Squamous metaplasia secondary to diffuse alveolar damage (DAD) or other infectious or inflammatory lung injury may acquire cytologic atypia resembling squamous cell carcinoma. 9, 18 July 2014 | Journal of Clinical Investigation, Vol. An immunohistochemical study using monoclonal antibody AE14, The human keratins: biology and pathology, Moll R, Franke WW, Schiller DL, Geiger B, Krepler R, The catalog of human cytokeratins: patterns of expression in normal epithelia, tumors and cultured cells, The 50- and 58-kdalton keratin classes as molecular markers for stratified squamous epithelia: cell culture studies, Intermediate filament proteins and their associated diseases, Toward unraveling the complexity of simple epithelial keratins in human disease, Apoptosis and keratin intermediate filaments, Directed expression of keratin 16 to the progenitor basal cells of transgenic mouse skin delays skin maturation, Intermediate filaments as signaling platforms.

Total mRNA levels of involucrin and K1 increased considerably in K14-knocdown cells (shRK14-D1 and -D2) as determined by real-time PCR (Figure 4C, D). Cells were grown in complete DMEM/IMDM medium for 14 d, with medium changes every 23 d. Cells were fixed with 4% paraformaldehyde for 1 h, which was followed by staining with 0.5% crystal violet (Himedia, in 70% ethanol) for 1 h at room temperature.

19, No. To generate stable K14 knockdown clones, 2 g of shRNA constructs or the empty vector were transfected into HaCaT and AW13516 cells using liposome-based FuGENE HD transfection reagent (Roche, Indianapolis, IN), and stable clones were selected in 0.5 g/ml puromycin-containing medium (according to the manufacturer's protocol). K14 knockdown cells also exhibited enhanced levels of activated Notch1, involucrin, and K1. Inflammatory infiltrates are common. These inherited human diseases exhibit cytolysis of epithelial cells, resulting in blistering of the corresponding epithelial sheets (Fuchs and Cleveland, 1998; Moll et al., 2008). 63, No. Akt's role in maintaining normal cell proliferation, growth, and differentiation is now well established (Fayard et al., 2005). K14 knockdown cells showed significantly decreased levels of phosphorylation at serine 473 residue of Akt compared with the vector control cells, whereas total Akt expression levels remained unchanged in these cells (Figure 3E). 124, No. Molecular Biology of the Cell is published by the American Society for Cell Biology. Our results showed that there was no substantial difference in caspase-3 and PARP activities between these cells (Figure S5C). It is estimated that each keratin intermediate filament contains 2000030000 keratin polypeptides. No significant difference in protein expression (Figure S2, A and C) and filament formation of K8 or K18 was observed in these clones (Figure S2, B and D). Oligonucleotides 5CAGCGAGCTGGTGCAATCCGGCAAGAGCGAGATCTCG3 from Sigma) were designed according to the manufacturer's protocol. Cells (n = 400) were plated in 60-mm tissue culture plates in triplicate. These observations imply that the K5/K14 pair is required for normal development and functioning of the basal cells and performs some unique regulatory functions. 1, 17 November 2020 | The FASEB Journal, Vol. The role of some other stratified epithelial keratins like K17 in regulation of epithelial cell growth via Akt-mTOR (target of rapamycin) pathways has been depicted using the knockout mouse model. The new term corneous beta protein (CBP) has been proposed to avoid confusion with -keratins.[12].

Rubbing and pressure cause thickening of the outer, cornified layer of the epidermis and form protective calluses, which are useful for athletes and on the fingertips of musicians who play stringed instruments. 16, No. 49, No. RT-PCR conditions were as follows: denaturation at 94C for 30 s; annealing at 56C and 58C for K14 and GAPDH, respectively, for 30 s; and extension at 72C for 60 s. RT-PCR products were run on agarose gel electrophoresis to compare RNA levels. 1, 23 April 2015 | International Journal of Molecular Sciences, Vol. 98, No. It undergoes dephosphorylation to form filaggrin, a histidine-rich protein which acts as a matrix glue and facilitates filament aggregation into even larger bundles. The signals were detected by using ECL Plus detection system (Amersham) according to the manufacturer's protocol. 110, No.

Mater. 1, 16 September 2019 | Journal of Clinical Investigation, Vol. In this study, we show decreased cell proliferation rate (Figure 2, A and B) in response to K14 knockdown. To ensure that the phenotypic changes observed upon K14 knockdown were not due to off-target effects of the shRNA construct, a rescue experiment was performed. Keratin expression is helpful in determining epithelial origin in anaplastic cancers. Keratin is extremely insoluble in water and organic solvents. Alpha-keratin (-keratin) is a type of keratin found in vertebrates. (C) Confocal analysis of involucrin and K1 levels in the indicated clones. Scale bars: 10 m. Limited interior space is the reason why the triple helix of the (unrelated) structural protein collagen, found in skin, cartilage and bone, likewise has a high percentage of glycine. 12, No. Alpha-keratins (-keratins) are found in all vertebrates. Cats regularly ingest hair as part of their grooming behavior, leading to the gradual formation of hairballs that may be expelled orally or excreted. The relative extractability of the keratins, in particular, is also dependent on the concentration of the chaotropes, reductant, and pH, thus providing a means to preferentially extract the KAPs. For example, in X-linked ichthyosis, there is an accumulation of cholesterol sulfate associated with a deficiency in aryl sulfatase, which results in decreased desquamation and keratin accumulation. 4, No.

These substances appear to have significant trophic effects in the intestinal mucosa (Underwood etal., 2005). 42, No. It is also possible that K5 and K14 may promote neoplastic progression in oral SCC by modulating PI3K/Akt and Notch1 signaling. Santanu Deb-Choudhury, Duane P. Harland, in Methods in Enzymology, 2016. Radlk leaf used by the Xhosa people of South Africa for the treatment of wound infections, Multiple roles for keratin intermediate filaments in the regulation of epithelial barrier function and apico-basal polarity, Mechanical Stretching Promotes Skin Tissue Regeneration via Enhancing Mesenchymal Stem Cell Homing and Transdifferentiation, Kaempferol targets Krt-14 and induces cytoskeletal mineralization in osteoblasts: A mechanistic approach, Anticancer effects of clinically acceptable colchicine concentrations on human gastric cancer cell lines, Vimentin-mediated regulation of cell motility through modulation of beta4 integrin protein levels in oral tumor derived cells, Layer-by-layer surface decoration of electrospun nanofibrous meshes for airliquid interface cultivation of epidermal cells, Methotrexate normalized keratinocyte activation cycle by overturning abnormal keratins as well as deregulated inflammatory mediators in psoriatic patients, The immunophenotypic relationship between the submucosal gland unit, columnar metaplasia and squamous islands in the columnar-lined oesophagus, Whole-transcriptome gene expression profiling in an epidermolysis bullosa simplex Dowling-Meara model keratinocyte cell line uncovered novel, potential therapeutic targets and affected pathways, Expression Profiling Reveals Genes Involved in the Regulation of Wool Follicle Bulb Regression and Regeneration in Sheep, Loss of keratin 19 favours the development of cholestatic liver disease through decreased ductular reaction, Isolation and Characterization of Human Adult Epithelial Stem Cells from the Periodontal Ligament, Angiotensin II inhibitor facilitates epidermal wound regeneration in diabetic mice, Community Structure Analysis of Transcriptional Networks Reveals Distinct Molecular Pathways for Early- and Late-Onset Temporal Lobe Epilepsy with Childhood Febrile Seizures, Loss of FOXA1 Drives Sexually Dimorphic Changes in Urothelial Differentiation and Is an Independent Predictor of Poor Prognosis in Bladder Cancer, Integrative investigation on breast cancer in ER, PR and HER2-defined subgroups using mRNA and miRNA expression profiling, Tracheal Dysplasia Precedes Bronchial Dysplasia in Mouse Model of N-Nitroso Trischloroethylurea Induced Squamous Cell Lung Cancer, Proteomic Analysis of Oral Cavity Squamous Cell Carcinoma Specimens Identifies Patient OutcomeAssociated Proteins, Microgravity might affect Peri-implant Mucosal Epithelial cells during space Flight, RETRACTED ARTICLE: Knockdown of filaggrin influences the epidermal terminal differentiation via MAPK pathway in normal human epidermal keratinocytes, Biological effect of ketamine in urothelial cell lines and global gene expression analysis in the bladders of ketamine-injected mice, Expression of the Ly6/uPAR-Domain Proteins C4.4A and Haldisin in Non-Invasive and Invasive Skin Lesions, Stem and Progenitor Cells of the Trachea and Proximal Airways, Air pollutants cause release of hydrogen peroxide and interleukin-8 in a human primary nasal tissue culture model, Influence of continuous negative pressure in the rat middle ear, Novel